

Kennen Sie Ihre Gene? Wissen Sie, wo sie stecken und wie sie wirken? Wissen Sie, welche Informationen sie enthalten? Wussten Sie, dass Ihre Gene und die einer Erdbeere oder eines Wurms in der gleichen Sprache geschrieben sind?

2. Nur zwei Nanometer Durchmesser, aber zwei Meter lang

Jedes Chromosom besteht aus einem einzelnen, einige Zentimeter langen DNA-Faden und verschiedenen Proteinen (Histonen), um welche die DNA gewickelt ist. DNA ist das Material, die chemische Substanz, aus welchem die Gene sind. DNA steht für das englische „deoxyribonucleic acid“ (Desoxyribonukleinsäure). Würde man alle 46 DNA-Fäden, welche in einem Zellkern auf die Chromosomen verteilt sind, aneinander reihen, dann wäre dieser Faden zwei Meter lang, aber nur winzige zwei Nanometer (1 nm = 1 Tausendstel Mikrometer) im Durchmesser. (siehe Video 1.2).

Video 1.2: Wie die DNA in Chromosomen verpackt wird.

Bei genauer Betrachtung zeigt sich, dass der DNA-Faden eigentlich aus zwei parallel verlaufenden Strängen besteht, die sich umeinander winden wie bei einer in sich verdrehten Strickleiter; man spricht von einer Doppelhelix. Die Seile der Strickleiter werden durch eine Zucker-Phosphat-Kette gebildet: Ein Zucker (Desoxyribose) und eine Phosphatgruppe wechseln sich ab. Interessanter für die Biologen sind jedoch die Sprossen der Strickleiter: Sie bestehen aus den Basen Adenin, Cytosin, Thymin und Guanin, welche mit A, C, T und G abgekürzt werden. Pro Stufe paaren sich jeweils entweder ein A und ein T, oder ein C und ein G. Diese vier Bausteine A, C, T und G bilden das Alphabet der Gene. Das Gen-Alphabet ist vergleichbar mit unserem aus 26 Buchstaben bestehenden Alphabet; nur dass das Gen-Alphabet aus lediglich vier Buchstaben besteht.

Der DNA-Faden ist eine Aneinanderreihung der Bausteine A, C, T und G. Das Hämoglobin-Gen zum Beispiel beginnt mit: CCCTGTGGAGCCACACCCTAG… und ist insgesamt 43’000 Bausteine lang. Seit dem Jahr 2003 wissen die Forschenden, wieviele solcher Bausteine insgesamt auf dem zwei Meter langen DNA-Faden des Menschen Platz haben: 3,2 Milliarden Bausteine. (siehe Video 1.3).

Video 1.3: DNA Aufteilung

Unnütze DNA?

Lediglich ein kleiner Anteil der DNA enthält Informationen und kann in Proteine übersetzt werden. Über 98% der DNA enthält anscheinend keinerlei Information und wurde daher „Junk-DNA“, also Abfall-DNA genannt. In den letzten Jahren haben Forscher jedoch herausgefunden, dass viele Sequenzen der „unnützen DNA“ wichtige biologische Funktionen haben wie zum Beispiel der Hemmung von Genen in der embryonalen Entwicklung oder der Stimulierung eines beim Alzheimer wichtigen Proteins. So ist ein ganz neuer Forschungszweig entstanden, der immer mehr Beachtung findet und noch viele weitere spannende Entdeckungen hervorbringen wird.